Hauptmenü öffnen

Zurück zur Übersicht

In der Biologie taucht der Begriff Information an einigen ganz zentralen Stellen auf. Als sehr gutes, immer noch lesenswertes Buch kann man dazu empfehlen:

  • Haken, Hermann; Haken-Krell, Maria: Entstehung von biologischer Information und Ordnung. Dimensionen der modernen Biologie Band 31989, Wissenschaftliche Buchgesellschaft, 1989, ISBN 3-534-02533-4 (X, 218 S. m. 68 Abb. Gebunden.).

Inhaltsverzeichnis

Information im ErbgutBearbeiten

Auf der nebenstehenden Abbildung sind die Ebenen der Informationsspeicherung im Erbgut zu erkennen:

 
Chromosomenkondensation
  1. DNA-  Doppelhelix Desoxyribonukleinsäure Doppelte Wendeltreppe
  2. Chromatinstrang (DNA in blau mit Histonen in grün)
  3. Kondensiertes Chromatin während der   Interphase mit Centromer
  4. Kondensiertes Chromatin während der   Prophase (nun aus zwei   Chromatiden bestehend, weil sich die DNA verdoppelt hat)
  5. Metaphasechromosom (Zwei-Chromatiden-Chromosom)

Vergessen wurde hier als erste Primärstruktur die Abfolge der Nukleotide: beispielsweise

  • AACTCGACTCCGGATTAGCAAGCC

und die Gliederung in Tripletts

  • AAC-TCG-ACT-CCG-GAT-TAG-CAA-GCC

Informationsneubildung bei der EvolutionBearbeiten

Informationsweitergabe bei der FortpflanzungBearbeiten

Informationsaufnahme durch sensible ZellenBearbeiten

Informationsverarbeitung im NervensystemBearbeiten

Informationsverarbeitung im HormonsystemBearbeiten

Informationsweitergabe durch PherormoneBearbeiten

Informationsspeicherung im Gehirn, lernende ZellenBearbeiten

Informationsvernichtung beim Tod eines LebewesensBearbeiten

Krankmachende Information z. B. in VirenBearbeiten

Informationsgehalt eines MenschenBearbeiten

Interessant ist die gesamte Menge an Informationen, die in einem menschlichen Körper gespeichert sind. Daraus ergibt sich beispielsweise, dass das   Beamen Quatsch ist:

Ulrich Walter (Physiker, Astronaut und Professor für Weltraumtechnik)
„Ein Mensch besteht aus ungefähr 10 hoch 27 Atomen. Die Zahl der Quantenzustände, also Bits, in denen diese sich befinden, beträgt 10 hoch 10 hoch 42, also eine Eins mit 10 hoch 42 Nullen. Das ist eine unvorstellbar große Datenmenge. Egal wie hoch die Übertragungsbandbreite ist, das lässt sich nicht übertragen. Und da haben wir noch nicht darüber geredet, wie man diese Informationen gewinnt und wieder zu einem Menschen zusammenbaut.“